Introduction
Chronic suppurative otitis media (CSOM) is one of the most common diseases of the middle ear particularly in childhood.1 It is a common health problem in a developing country like India especially in the lower socio economic status.Generally, microbiological culture of the ear discharge simplicates Pseudomonas aeruginosa, Proteus spp and Staphylococcus as the prevalent causative organism.2 Pseudomonas aeruginosa, is one of the most common organisms to cause CSOM. Among the beta lactams, carbapenems are considered as the potent drug of choice for serious treatment of gram-negative bacteria infections. The most effective antibiotics that can be used against Pseudomonas aeruginosa are ß- lactam antibiotics in which imipenem as a carbapenem is considered as the most appropriate antibiotic to be used against the mentioned organisms.
Worldwide, the prevalence of gram negative bacteria with multi-drug resistance profiles is now recognized. Carbapenem resistance occurs because of the production of carbepenemases as there is decrease in antibiotics absorption. Carbapenemases acquires resistance belongs to Ambler molecular classes A, B and D. Metallo–beta-lactamases (MBL) enzymes are the most significant carbapenemases. Nowadays the emergence of antibiotic resistance strains is one of the challenges in treating patients, such as MBLs producing Pseudomonas aeruginosa.3
The VIM, IMP and SPM types are the most clinically significant carbapenemases which is encoded by blaVIM, blaIMP, and blaSPM genes.4 Therefore, this study is undertaken to study the Molecular Characterization of Metallo-Beta Lactamase GeneblaIMP-1 in Imipenem Resistant Pseudomonas aeruginosa isolates from Patients of Chronic Suppurative Otitis Media at a Tertiary care hospital.
Materials and Methods
This was a hospital based cross sectional study carried out in the Department of Microbiology and ENT Department at RMCH & RC, Kanpur over a period of one year from July 2021 to July 2022. Ethical clearance was duly obtained from the Institute Ethical Committee for conducting the study. A total of 185 patients was included in our study. All adult patients who consented to participate in the study were included and Patients already on antibiotics were excluded.
Specimen collection ans sample processing
The sample was collected using Pus swab from the external auditory canal and introduced into Amies transport medium bottle and sent for laboratory analysis. The sample was processedto primary gram stain for pus cells and inoculated into Blood agar (Oxoid, UK), and MacConkey agar (Oxoid, UK) and incubated aerobically at 37 °C for 24–48 h.
Screening, isolation and identification of organisms
Identification of pathogens was based on Microscopy and colony characteristics (colony morphology, hemolysis on blood agar, changes in the physical appearance of the differential media). Gram positive isolates were tested for catalase and Coagulase tests while biochemical tests for gram negative isolated bacteria were tested for oxidase, Triple sugar Iron (TSI), Sulphur indole and motility (SIM), urease production and citrate utilization.5
Antimicrobial susceptibility testing
Antibiotic susceptibility test of isolated bacterial pathogens were performed using modified Kirby Bauer disc diffusion method according to the Clinical and Laboratory Standard Institute (CLSI) guidelines.6
A colony suspension with concentration equivalent to 0.5 McFarland solution was prepared for each identified isolate and inoculated into Mueller–Hinton-Agar (Oxoid, UK). Appropriate Selected Antibiotic discs were placed onto the media and incubated at 37 °C for 24 h. Gram positive isolates were tested against Ampicillin (10 µg), Amoxicillin/clavulanate (20/10 µg), Ceftriaxone (30 µg), Gentamycin (10 µg), Ciprofloxacin (5 µg), Trimethoprim/sulfamethoxazole (1.25/23.75 µg), Chloramphenicol (30 µg), Amikacin (17 µg) and Cephalexin (18 µg), Cefoxitin (30µg). Gram negative organisms were tested sensitivity to amikacin (AMK, 30 μg), gentamicin (GM, 10 μg), tobramycin (TOB, 10 μg), ceftazidime (CAZ, 30 μg), cefepime (CFP, 50 μg), piperacillin (PIP, 100 μg), PIP/tazobactam (PTZ, 100/10 μg), imipenem (IMP, 10 μg), ciprofloxacin (CIP, 5 μg), and levofloxacin (LFX, 5 μg) by modified Kirby Bauer disc diffusion method using Mueller Hinton agar (MHA) medium. A suspension of the isolated colonies of each test strain equivalent to a 0.5 McFarland’s standard was prepared in sterile normal saline. Briefly, a suspension of each strain was made so that the turbidity was equal to 0.5 McFarland standards and then plated as a lawn culture on to MHA. Antibiotic discs were placed and plates were incubated at 37°C for 18–24 h. Results were interpreted in accordance with CLSI guidelines6 Escherichia coli ATCC 25922, Staphylococcus aureus (American Type Culture Collection; ATCC 25923 and P. aeruginosa ATCC 27853 were used as control strains.
Phenotypic confirmatory test
Imipenem(IMP)- EDTA Combined disc test: The test organisms are inoculated by lawn culture technique on the plates of Muller-Hinton agar(MHA) as recommended by CLSI.7 10 μg Imipenem Disk and 750 μg Imipenem-EDTA Disk(Hi-media SD281) are placed on the plate. The inhibition zones of the imipenem and imipenem-EDTA disks are compared after 16 to 18 hours of incubation at 37°C. In the combined disc test, if the increase in inhibition zone with the imipenem and EDTA disc will be ≥ 7 mm than the imipenem disc alone, it is considered as MBL positive.8
MBL E test: The E-test MBL Strip contains a double sided seven-dilution range of IP(Imipenem) (4 to 256 μg/ml) and Imipenem (1 to 64μg/ml) in combination with a fixed concentration of EDTA is considered as the most sensitive method for MBL detection]. The E-test was done according to manufacturer’s instructions. MIC ratio of IP/ IPI (Imipenem+EDTA) of >8 or >3 log dilutions indicates MBL production.8
Genotypic detection of blaIMP-1 gene in P. aeruginosa
The DNA was extracted from P. aeruginosa using the Qiagen DNA Extraction Kit as per manufactures guidelines.
Molecular analysis
Polymerase chain reaction (PCR) was carried out for detection of blaIMP, gene on a thermal cycler (Eppendorf, Germany). The primer pair sequences used in this study and the PCR conditions is described in the below Table 1. The DNA extraction was performed and the electrophoresis unit was run where 2% agarose gel was prepared with ethidium bromide. The bromophenonol blue dye was used for loading our DNA product which was then visualized in the gel documentation system. Positive controls used in this test were SPM-1 producing P. aeruginosa 16 strain (provided by Prof. Patrick Nordmann), blaIMP-1 from Seratia marcesens (sequenced by Bioneer company), and blaVIM. P. aeruginosa ATCC 27853 was used as a negative control.9
Table 1
The Nucleotide sequences of primers used for detection of metalo-beta lactamase genes.9
|
Primer name |
Sequence |
Denaturing |
Anneal |
Extension |
Cycles |
Size(bp) |
|
blaIMP-1 |
5′TGAGCAAGTTATCTG ATTC3′ 5′ TTAGTTGCTTGGTTTTGATG 3′ |
94°C, 60 s |
57°C, 60 s |
72°C, 2 min |
35 |
740 |
Results
In our study the clinically diagnosed suspected cases having CSOM were 185, out of which 63 (34%) was found to be positive for CSOM infection. The ratio of Male 38 (60.3%) were found to be more as compared to that of Female 25 (39.6%), which is illustrated in the Table 2.
Table 2
Genderwise distribution of chronic suppurative otitis media patients
|
S.N. |
Gender |
Isolates N=63 |
Percentage (%) |
|
1. |
Male |
38 |
60.3% |
|
2. |
Female |
25 |
39.6% |
The maximum number of cases reported was observed in the age group of 0-10 years followed by 11-20 years of age and the least number of cases was seen in the age group above 51 years of age Table 3.
Table 3
Age wise distribution of the CSOM culture positive isolates
Table 4
Bilateral distribution of chronic suppurative otitis media culture positive patients
|
S.N. |
Side of the ear |
Isolates N=63 |
Percentage (%) |
|
1. |
Left |
32 |
50.7% |
|
2. |
Right |
28 |
44.4% |
|
3. |
Bilateral |
3 |
4.7 |
|
4. |
Total |
63 |
100% |
The side of the ear affected was almost in equal distribution, with the left ear being 32(50.7%) and the right ear being 28 (44.4%) while 3 (4.7%) were bilateral Table 4. In our study it was observed that the maximum number of cases was found in Gram negative bacilli isolates (74.6%) as compared to the Gram positive isolates (25.3%). It was also observed that 55 isolates (87.3%) samples showed growth of single isolates while 8 (12.6%) were mixed isolates.
Table 5
Distribution of bacterial isolates from CSOM patients
P. aeruginosa (47.6%) was the most common isolate followed by Klebsiella spp 19% and among gram positive isolates Staphylococcus aureus was 12.6%.
Table 6
Phenotypic confirmatory test for MBL detection in Imipenem resistant Pseudomonas aeruginosa isolates from CSOM patients
|
Organisms |
Imipenem(IMP)- EDTA Combined disc test: |
E-test |
|
Pseudomonas aeruginosa |
11/30 |
11/30 |
Figure 1
A: and B: shows MBL positive by Imipenem (IMP)- EDTA Combined disc test MBL positive by E-Test
Pseudomonas aeruginosa isolated 11(36.6%)were screening test-positives for MBL by Imipenem – EDTA combined disc test, and MBL E test (Imipenem).
Table 7
Shows isolation rate of Pseudomonas aeruginosa strains susceptible and resistant to each antibiotic class (n=30)
The sensitivity observed in P. aeruginosa for Colistin was (96.6%), Piperacillin‑tazobactam (73.3%), Amikacin (76.6.3%), and Cefepime (73.3%) were found to be the most effective Antibiotics. The resistance to ciprofloxacin was (56.6%), Levofloxacin (50%), Piperacillin(46.6%), Gentamicin(36.6%), Imipenem (36.6%), Tobramycin(30%), Ceftazidime (30%) and Gentamycin (36.6%). The blaIMP-1 gene was detected in 11 (36.6%) of the isolates of Pseudomonas aeruginosa. S. aureus showed a 100% sensitivity to Vancomycin, Linezolid Pneumoniae showed 100% sensitivity to gentamicin, netilmicin, levofloxacin, and ofloxacin P. mirabilis showed a sensitivity of 80% sensitivity to levofloxacin and 80.9 % to ofloxacin, respectively, followed by ceftazidime and gentamicin 65%, ceftriaxone 57%. E. coli showed a sensitivity of 92.2% and 94.1% to gentamicin and levofloxacin, respectively, followed by ofloxacin 90.2%,ceftazidime 70.6%, ceftriaxone 78.4%, netilmicin 78.4%, and tetracycline 64.7%. Klebsiella species showed a sensitivity of 100% to levofloxacin and ofloxacin, respectively, followed by netilmicin, ceftazidime, ceftriaxone with 95.8%, tetracycline and gentamicin with 75 %.
The DNA Extraction was performed by the Qiagen DNA kit and the DNA was isolated from the samples.
Discussion
The CSOM presents as painless discharge and is the most common cause of deafness in India. Various studies have shown that both gram positive as well as gram negative organisms are responsible for CSOM.10 In our study the number of ears clinically diagnosed of having CSOMs was 185, out of which 63 (34%) was found to be positive for CSOM infection. Our study was in support with the study performed by Deepthi Maringanti et al.,11 where, the ear discharge swabs were sent for Culture and Sensitivity in which only 106 patients out of 180, showed culture positives.
The ratio of Male 38 (60.3%) were found to be more as compared to that of Female 25 (39.6%) in our study. This finding was similar to the study by Mohammed Jamiu Kazeem12 where 198 (52.1%) patients were male while 182 (47.9%) were female. Other studies by Okesola and Fasina13 and Akingbadeet al.,7 was also in support with our study but in contrast with the study by Shrestha et al.,14 The maximum number of cases reported was observed in the age group of 0-10 years followed by 11-20 years of age and the least number of cases was seen in the age group above 51 years of age. This study was in support with the study performed by the other author12 where maximum number of cases was reported in the age group of 10 years age with the fact that CSOM is predominantly a childhood disease, particularly the under 10 and least was observed above the age group of 50 years. This may be because of the week immune system in the young age and also because eustachian tubes are wider, shorter, and straighter compared to that of the adult.
The side of the ear affected was almost in equal distribution, with the left ear being 32 (50.7%) and the right ear being 28 (44.4%) while 3 (4.7%) were bilateral . This study was in support with the study by Mohammed Jamiu Kazeem12 where the distribution pattern of the right and the left ear was in and the equal while bilateral was 3.4%.
In our study it was observed that the maximum number of cases was found in Gram negative isolates as compared to the Gram positive isolates and only 1.5% with Fungal isolates. It was also observed that 87.3% samples showed growth of single isolates while 12.6% were mixed isolates. This was in support with the study.12
This current study showed that P. aeruginosa (47.6%) has the highest prevalence of the isolated organism. This correlates with the studies performed by other authors where the incidence of P. aeruginosa as the most commonly isolated organism in CSOM ranging from 21%-52.94%.15 Another study by Loy et al. (33.3%)16 and Mansooret al. (40%)17 also stated the rate of P. aeruginosa was more with no fungal isolate, but in Contrast with the study by Adoga et al. where Klebsiella species (40%) as the predominant organism.18
In our study Klebsiella spp. was the second most common isolate followed by Staphylococcus aureus with 12.6%, Escherichia coli (9.5%), Proteus mirabilis (4.7%) and Streptococcus pneumonia (1.58%) being the least observed. This correlate with the study by the Nwankwo and Salisu.19
Furthermore, this study showed that the commonly available antibiotics such as ciprofloxacin, and levofloxacin were generally ineffective against P. aeruginosa, species, which is the most isolate in our study. This is in support with the reports of Nwabuisi and Ologe.20 Moreover, the ineffectiveness may be due to indiscriminate use of antibiotics, resulting in the emergence of resistant strains.
Piperacillin –tazobactam, Imipenem, Cefepime and Amikacin though highly sensitive, are considered as effective drugs in CSOM cases which are not responding to ciprofloxacin and Levofloxacin. Although still the sensitivity is declining so there is a need to quickly check the menace of inappropriate treatment of CSOM by quacks and intensify campaign against self‑medication.
Conclusion
CSOM as similar to other chronic disease can limit an individual’s employability and quality of life. In the present study Pseudomonas aeruginosa being the most common isolate with Colistin, Piperacillin‑tazobactam, Amikacin, and cefepime to be the most effective antibiotics. Resistance of P. aeruginosa isolates to Imipenem due to MBL enzymes is increasing in the Kanpur region (36.6%). Judicial use of broad spectrum antibiotics, like Imipenem is the need of the hour, hence knowledge of the etiological agents of CSOM and their antibiogram data should be utilized for formulating antibiotic policy as it is paramount importance for an efficient treatment and prevention of both disease complications that it helps in preventing the emergence and spread of resistant pathogens.
Article DOI
